Home
(current)
Search
Browse
Help
Downloads
Home
(current)
Search
Browse
Help
Downloads
miRBase entry: hco-miR-5897c
Mature
hco-miR-5897c
Accession
MIMAT0023380
Description
hco-miR-5897c mature miRNA
Hairpins
hco-mir-5897c
Sequence
UUUUGUAUGUAUUAUCUGGAAUU
Copy Sequence
Evidence
experimental
Illumina [1]