Stem-loop sequence hco-mir-5897c

AccessionMI0020052 (change log)
DescriptionHaemonchus contortus miR-5897c stem-loop
Gene family MIPF0001517; mir-5897
Stem-loop
   u     gaaga     c         u         u  ga c 
5'  gguug     acagu ccagaugau cguacaaag cc  c a
    |||||     ||||| ||||||||| ||||||||| ||  |  
3'  ccaac     uguua ggucuauua guauguuuu gg  g u
   -     --acg     a         u         -  ag a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5897c

Accession MIMAT0023380
Sequence

52 - 

uuuuguauguauuaucuggaauu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).