Stem-loop sequence hco-mir-235

AccessionMI0020060 (change log)
DescriptionHaemonchus contortus miR-235 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ------augaaca     u   u   c      u  u   u   c       g 
5'              cuucg gug cgg uagguc gg cga ugc auguuug c
                ||||| ||| ||| |||||| || ||| ||| ||||||| u
3'              gaagc cac guc guccgg cc gcu acg uauaagc a
   ucccagcuuucca     -   -   a      c  c   c   u       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-235

Accession MIMAT0023388
Sequence

56 - 

uauugcacucgccccggccuga

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).