Stem-loop sequence hco-mir-5921

AccessionMI0020067 (change log)
DescriptionHaemonchus contortus miR-5921 stem-loop
Stem-loop
   ----a   cuccuacu  c    a   u    u    u       a  uagg 
5'      uuc        ug agac uuc gcaa gaaa cuaguag cc    a
        |||        || |||| ||| |||| |||| ||||||| ||    g
3'      aag        ac ucug aag cguu cuuu gauuauc gg    a
   ucaua   -cauaguu  c    a   c    c    u       c  uaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5921-5p

Accession MIMAT0023395
Sequence

23 - 

cugcaaugaaaucuaguagaccua

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hco-miR-5921-3p

Accession MIMAT0023396
Sequence

58 - 

ccuauuaguuuuccuugccgaa

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).