Stem-loop sequence hco-mir-5924-1

AccessionMI0020074 (change log)
DescriptionHaemonchus contortus miR-5924-1 stem-loop
Gene family MIPF0001523; mir-5924
Stem-loop
   --a      --g                a      ca  u     a  ucuu 
5'    aggucc   uuuaugagauauguca cacagc  ga gcagu gu    u
      ||||||   |||||||||||||||| ||||||  || ||||| ||     
3'    uccggg   aaauacucuauacagu gugucg  cu cguca ca    u
   uac      aga                c      ac  u     a  cugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5924-5p

Accession MIMAT0023403
Sequence

23 - 

caacacagccagaugcaguag

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hco-miR-5924-3p

Accession MIMAT0023404
Sequence

57 - 

aacugcuuccagcugugcugacau

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).