Stem-loop sequence hco-mir-5930

AccessionMI0020085 (change log)
DescriptionHaemonchus contortus miR-5930 stem-loop
Stem-loop
   ca   -   agac  a    a  ----cag       g   -   a      cg 
5'   guu cug    cg uguu ag       gggcgac uag aac caugca  u
     ||| |||    || |||| ||       ||||||| ||| ||| ||||||   
3'   caa gac    gc gcag uc       cccgcug auc uug guacgu  g
   -c   c   ---a  a    a  accacag       -   g   a      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5930

Accession MIMAT0023416
Sequence

23 - 

caggggcgacguagaacacaugca

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).