Stem-loop sequence hco-mir-5943

AccessionMI0020108 (change log)
DescriptionHaemonchus contortus miR-5943 stem-loop
Stem-loop
   a  -             ag     c      --   ugu     
5'  cu gucgcgccgucgg  cgucc gcugag  gcc   ccgc 
    || |||||||||||||  ||||| ||||||  |||   ||| a
3'  ga cggcguggcggcc  gcggg cgacuc  ugg   ggcu 
   g  u             cu     a      gu   --u     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5943

Accession MIMAT0023439
Sequence

11 - 

cgucggagcgucccgcugaggc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).