Stem-loop sequence hco-mir-63b

AccessionMI0020109 (change log)
DescriptionHaemonchus contortus miR-63b stem-loop
Literature search

1 open access papers mention hco-mir-63b
(1 sentences)

Stem-loop
   -   gucc              c gu   cauc     c   g 
5'  cuc    ucacuccgauucgc g  agu    gucau ggu a
    |||    |||||||||||||| |  |||    ||||| |||  
3'  gag    agugggguuaagcg c  uca    cagua uca g
   c   -auu              - ug   ----     -   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-63b

Accession MIMAT0023440
Sequence

47 - 

cuaugacacugucgcgaauugggg

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).