Stem-loop sequence hco-mir-5971

AccessionMI0020146 (change log)
DescriptionHaemonchus contortus miR-5971 stem-loop
Stem-loop
   -------ca     --      uauauu     -ggu    aaua    a --g      -     g 
5'          cuauc  gcuuug      gcggg    gaug    guga u   ggaauc ucuau a
            |||||  ||||||      |||||    ||||    |||| |   |||||| |||||  
3'          gguag  cgaagu      cgccc    cugc    cacu a   cuuuag agaug a
   gcuacggug     uc      -----u     aguc    ---g    a aaa      u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5971

Accession MIMAT0023478
Sequence

58 - 

guagaugauuucaaaaaucacgcguccugacccg

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).