Stem-loop sequence hco-mir-5892b

AccessionMI0020154 (change log)
DescriptionHaemonchus contortus miR-5892b stem-loop
Gene family MIPF0001539; mir-5892
Stem-loop
   ----------------------------cgagccuuccg     -   gu                         c  ---  g 
5'                                        guccu gaa  uugcucagaugauccagauguuagu gc   cc c
                                          ||||| |||  ||||||||||||||||||||||||| ||   ||  
3'                                        uagga cuu  agcgagucuacuagguuuacaauua cg   gg a
   cacgucaucuaccuuauuccucauguccgaagcuuaucg     g   au                         a  aaa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5892b

Accession MIMAT0023486
Sequence

63 - 

aauuaacauuuggaucaucugagc

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).