Stem-loop sequence hco-mir-5979

AccessionMI0020157 (change log)
DescriptionHaemonchus contortus miR-5979 stem-loop
Stem-loop
   -------gcgca   aaua                                 acau 
5'             gga    uguauguucauggaugaucgcgaaagugccaug    c
               |||    |||||||||||||||||||||||||||||||||     
3'             ccu    auauacaaguacuuacuagcguuuucacgguac    c
   gucaaaagauaa   ----                                 cuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5979

Accession MIMAT0023489
Sequence

23 - 

uggaugaucgcgaaagugccauga

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).