Stem-loop sequence hco-mir-5990

AccessionMI0020175 (change log)
DescriptionHaemonchus contortus miR-5990 stem-loop
Stem-loop
   gggagauuagucuagagcagauuagucugauauaggc      cu -         ac   u  u    a 
5'                                      gucuua  c cggaguaca  caa uu auga a
                                        ||||||  | |||||||||  ||| || ||||  
3'                                      cagagu  g gucuuaugu  guu aa uacu a
   ------------------------------------c      -u c         -a   u  c    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5990-5p

Accession MIMAT0023506
Sequence

71 - 

aaucaucaauuugauguauucug

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).