Stem-loop sequence spu-mir-92d

AccessionMI0020183 (change log)
DescriptionStrongylocentrotus purpuratus miR-92d stem-loop
Literature search

1 open access papers mention spu-mir-92d
(2 sentences)

Stem-loop
   --    a  cu        ----u   ug c 
5'   gucg gg  aguguaau     cug  a a
     |||| ||  ||||||||     |||  | g
3'   cggc cc  ucacguua     gac  u c
   gu    c  au        ugaac   gu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
AAGJ05134155.1: 22230-22288 [+]
intergenic
Clustered miRNAs
< 10kb from spu-mir-92d
spu-mir-92dAAGJ05134155.1: 22230-22288 [+]
spu-mir-92eAAGJ05134155.1: 22757-22817 [+]
Database links

Mature sequence spu-miR-92d

Accession MIMAT0023512
Sequence

40 - 

uauugcacuuaccccggcug

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1