Stem-loop sequence spu-mir-92e

AccessionMI0020184 (change log)
DescriptionStrongylocentrotus purpuratus miR-92e stem-loop
Stem-loop
   --     u               cug ug c 
5'   ggucg ggugagugcaauguu   u  u u
     ||||| |||||||||||||||   |  | c
3'   ucggc ccauucacguuauaa   a  a g
   au     c               --a gu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
AAGJ05134155.1: 22757-22817 [+]
intergenic
Clustered miRNAs
< 10kb from spu-mir-92e
spu-mir-92dAAGJ05134155.1: 22230-22288 [+]
spu-mir-92eAAGJ05134155.1: 22757-22817 [+]
Database links

Mature sequence spu-miR-92e

Accession MIMAT0023513
Sequence

41 - 

uauugcacuuaccccggcuua

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1