Stem-loop sequence cgr-mir-1343

AccessionMI0020398 (change log)
DescriptionCricetulus griseus miR-1343 stem-loop
Gene family MIPF0001206; mir-1343
Stem-loop
   aaugcu  u    u   u  c    a    cu      -ca    ucu 
5'       gc ggcu cgg gc gggg gcgg  cccggg   ggcc   g
         || |||| ||| || |||| ||||  ||||||   ||||    
3'       cg ccgg gcc cg ucuc cgcc  gggucc   ccgg   c
   ------  c    -   u  c    a    cg      ucc    ucu 
Get sequence
Deep sequencing
21854 reads, 33.3 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000070.1: 1730781-1730870 [+]
intergenic
Database links

Mature sequence cgr-miR-1343

Accession MIMAT0023761
Sequence

58 - 

cuccuggggcccgcacucucgcu

 - 80

Get sequence
Deep sequencing154 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).