Stem-loop sequence cgr-mir-141

AccessionMI0020403 (change log)
DescriptionCricetulus griseus miR-141 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   gacu    uu   u       --    u          au    gaa 
5'     ggcu  ggg ccaucuu  ccag gcaguguugg  gguu   g
       ||||  ||| |||||||  |||| ||||||||||  ||||   u
3'     cugg  ccc gguagaa  gguc ugucacaauc  ucga   a
   ---a    gc   c       au    -          -c    agu 
Get sequence
Deep sequencing
23153 reads, 33.3 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000031.1: 4002691-4002780 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-141
cgr-mir-200cJH000031.1: 4002276-4002365 [+]
cgr-mir-141JH000031.1: 4002691-4002780 [+]
Database links

Mature sequence cgr-miR-141

Accession MIMAT0023769
Sequence

58 - 

uaacacugucugguaaagauggc

 - 80

Get sequence
Deep sequencing47 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).