Stem-loop sequence cgr-mir-143

AccessionMI0020405 (change log)
DescriptionCricetulus griseus miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

1 open access papers mention cgr-mir-143
(4 sentences)

Stem-loop
   cuguc    ag      g         g      u  -  ag 
5'      uccc  ccugag ugcagugcu caucuc gg uc  u
        ||||  |||||| ||||||||| |||||| || ||   
3'      aggg  ggacuc augucacga guagag cu ag  u
   -----    aa      g         a      u  g  gg 
Get sequence
Deep sequencing
24379 reads, 33.3 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000986.1: 202913-202992 [-]
intergenic
Database links

Mature sequence cgr-miR-143

Accession MIMAT0023772
Sequence

51 - 

ugagaugaagcacuguagcuc

 - 71

Get sequence
Deep sequencing309 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).