Stem-loop sequence cgr-mir-215

AccessionMI0020461 (change log)
DescriptionCricetulus griseus miR-215 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   --       a a  a     -    u        g   gg 
5'   uacagga a ug ccuau gaau gacagaca uau  c
     ||||||| | || ||||| |||| |||||||| |||   
3'   augucuu u ac ggaug cuua cugucugu aug  u
   gu       a a  c     u    -        -   ug 
Get sequence
Deep sequencing
297717 reads, 3.62e+03 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000002.1: 3327065-3327141 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-215
cgr-mir-194JH000002.1: 3326794-3326873 [+]
cgr-mir-215JH000002.1: 3327065-3327141 [+]
Database links

Mature sequence cgr-miR-215-5p

Accession MIMAT0023853
Sequence

10 - 

augaccuaugaauugacagaca

 - 31

Get sequence
Deep sequencing279223 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-215-3p

Accession MIMAT0023854
Sequence

47 - 

ucugucauucuguaggccaau

 - 67

Get sequence
Deep sequencing543 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).