Stem-loop sequence cgr-mir-221

AccessionMI0020464 (change log)
DescriptionCricetulus griseus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

2 open access papers mention cgr-mir-221
(7 sentences)

Stem-loop
   --  -   a    -  ug   u         auuu    -   u 
5'   gg ggc ugaa cc  gca acaauguag    cugu guu a
     || ||| |||| ||  ||| |||||||||    |||| ||| u
3'   cc ucg acuu gg  cgu uguuacauc    gaca cgg u
   gu  a   g    u  gu   c         ----    a   a 
Get sequence
Deep sequencing
160086 reads, 1.62e+03 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000515.1: 1085312-1085393 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-221
cgr-mir-222JH000515.1: 1084728-1084808 [+]
cgr-mir-221JH000515.1: 1085312-1085393 [+]
Database links

Mature sequence cgr-miR-221-5p

Accession MIMAT0023858
Sequence

10 - 

accuggcauacaauguagauuucugu

 - 35

Get sequence
Deep sequencing75112 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-221-3p

Accession MIMAT0023859
Sequence

50 - 

agcuacauugucugcuggguuuc

 - 72

Get sequence
Deep sequencing65691 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).