Stem-loop sequence cgr-mir-25

AccessionMI0020470 (change log)
DescriptionCricetulus griseus miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ------c   a     c g    gag    g     uu g     u   --  aa 
5'        ggg cuggc a uguu   aggc gagac  g gcaau gcu  gg  g
          ||| ||||| | ||||   |||| |||||  | ||||| |||  ||  c
3'        ccc ggccg u acag   ucug cucug  c cguua cgg  cc  u
   gucacaa   -     - g    ---    g     uu a     -   gu  cg 
Get sequence
Deep sequencing
168251 reads, 1.83e+03 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001296.1: 178664-178762 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-25
cgr-mir-106bJH001296.1: 179099-179179 [-]
cgr-mir-93JH001296.1: 178880-178960 [-]
cgr-mir-25JH001296.1: 178664-178762 [-]
Database links

Mature sequence cgr-miR-25-5p

Accession MIMAT0023869
Sequence

21 - 

aggcggagacuugggcaauugcu

 - 43

Get sequence
Deep sequencing6746 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-25-3p

Accession MIMAT0023870
Sequence

59 - 

cauugcacuugucucggucuga

 - 80

Get sequence
Deep sequencing136977 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).