Stem-loop sequence cgr-mir-32

AccessionMI0020490 (change log)
DescriptionCricetulus griseus miR-32 stem-loop
Gene family MIPF0000069; mir-32
Stem-loop
   -cug          ug     u           -  uu  c 
5'     guggagauau  cacau acuaaguugca ug  gu a
       ||||||||||  ||||| ||||||||||| ||  ||  
3'     cacuuuuaua  gugug ugauuuaacgu ac  cg c
   agug          gu     -           g  uc  g 
Get sequence
Deep sequencing
19754 reads, 33.3 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000228.1: 1290648-1290728 [-]
intergenic
Database links

Mature sequence cgr-miR-32-5p

Accession MIMAT0023904
Sequence

11 - 

uauugcacauuacuaaguugc

 - 31

Get sequence
Deep sequencing1480 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-32-3p

Accession MIMAT0023905
Sequence

52 - 

caauuuagugugugugauauu

 - 72

Get sequence
Deep sequencing32 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).