Stem-loop sequence cgr-mir-381

AccessionMI0020517 (change log)
DescriptionCricetulus griseus miR-381 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   uauug           a  c   g        u        --g   u 
5'      uuugguacuua ag gag uugcccuu guauauuc   guu a
        ||||||||||| || ||| |||||||| ||||||||   |||  
3'      aaacuaugagu uc cuc aacgggaa cauauaag   cag u
   -----           g  u   g        -        gua   u 
Get sequence
Deep sequencing
19420 reads, 33.3 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000884.1: 55360-55449 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-381
cgr-mir-300JH000884.1: 52952-53041 [+]
cgr-mir-381JH000884.1: 55360-55449 [+]
cgr-mir-382JH000884.1: 62756-62835 [+]
cgr-mir-134JH000884.1: 63116-63195 [+]
Database links

Mature sequence cgr-miR-381

Accession MIMAT0023946
Sequence

59 - 

uauacaagggcaagcucucugu

 - 80

Get sequence
Deep sequencing21 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).