Stem-loop sequence cgr-mir-425

AccessionMI0020524 (change log)
DescriptionCricetulus griseus miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
   - u  u    aau       u  c     u  ----ag   g 
5'  g gc uugg   gacacga ca ucccg ug      ugg c
    | || ||||   ||||||| || ||||| ||      |||  
3'  c cg gacc   cugugcu gu agggc ac      acc a
   u u  u    cgc       -  a     u  cgaaga   c 
Get sequence
Deep sequencing
68992 reads, 533 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH001800.1: 109479-109558 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-425
cgr-mir-191JH001800.1: 109036-109118 [+]
cgr-mir-425JH001800.1: 109479-109558 [+]
Database links

Mature sequence cgr-miR-425-5p

Accession MIMAT0023958
Sequence

10 - 

aaugacacgaucacucccguuga

 - 32

Get sequence
Deep sequencing44489 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-425-3p

Accession MIMAT0023959
Sequence

50 - 

caucgggaaugucguguccgc

 - 70

Get sequence
Deep sequencing3540 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).