Stem-loop sequence cgr-mir-450b

AccessionMI0020527 (change log)
DescriptionCricetulus griseus miR-450b stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
             uuu     u        g     auaa 
5' gcagaauuau   ugcag auguuccu aauac    u
   ||||||||||   ||||| |||||||| |||||    a
3' uguuuuaaug   acguu uacaaggg uuaug    u
             uau     u        -     cgaa 
Get sequence
Deep sequencing
20295 reads, 16.7 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000353.1: 1169242-1169317 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-450b
cgr-mir-322JH000353.1: 1175630-1175707 [-]
cgr-mir-503JH000353.1: 1175314-1175393 [-]
cgr-mir-542JH000353.1: 1170704-1170782 [-]
cgr-mir-450aJH000353.1: 1169406-1169480 [-]
cgr-mir-450bJH000353.1: 1169242-1169317 [-]
Database links

Mature sequence cgr-miR-450b-5p

Accession MIMAT0023962
Sequence

11 - 

uuuugcaguauguuccugaaua

 - 32

Get sequence
Deep sequencing3995 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-450b-3p

Accession MIMAT0023963
Sequence

46 - 

uauugggaacauuuugcauaug

 - 67

Get sequence
Deep sequencing3606 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).