Stem-loop sequence ptr-mir-92b

AccessionMI0020575 (change log)
DescriptionPan troglodytes miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   agc   auccc     cc   c    g     ga       c            uuuuu 
5'    ggg     gggcc  ggg gggc ggagg  cgggacg ggugcaguguug     u
      |||     |||||  ||| |||| |||||  ||||||| ||||||||||||     c
3'    ccc     cccgg  ccc cccg ccucc  gcccugc ucacguuauaac     c
   ---   -----     -c   -    g     -g       -            cgccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 133283049-133283157 [+]
intergenic
Database links

Mature sequence ptr-miR-92b

Accession MIMAT0024028
Sequence

71 - 

uauugcacucgucccggccucc

 - 92

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).