Stem-loop sequence ptr-mir-3149

AccessionMI0020603 (change log)
DescriptionPan troglodytes miR-3149 stem-loop
Gene family MIPF0001935; mir-3149
Stem-loop
   aaaggacaucaaaaug ga                          aucc   c     cau 
5'                 g  uauacauacauguacacacacauguc    aca acaua   a
                   |  ||||||||||||||||||||||||||    ||| |||||    
3'                 c  auauguguguguauguguguguauag    ugu uguau   u
   -----------caaga ac                          -gua   u     aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr8: 78240733-78240844 [-]
intergenic
Database links

Mature sequence ptr-miR-3149

Accession MIMAT0024056
Sequence

71 - 

uuuguauggauaugugugugua

 - 92

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).