Stem-loop sequence ggo-mir-1301

AccessionMI0020705 (change log)
DescriptionGorilla gorilla miR-1301 stem-loop
Gene family MIPF0000742; mir-1301
Stem-loop
   cugccaagcgacccc    au          g           -     - c      -  gu 
5'                uaga  ggggauugug ggggucgcucu aggca c gcagca cu  g
                  ||||  |||||||||| ||||||||||| ||||| | |||||| ||  c
3'                gucu  cuccugacac cuucagugagg uccgu g cguugu gg  u
   ------------ucc    --          a           g     c a      a  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr2A: 82109956-82110067 [+]
sense
ENSGGOT00000012583 ; DNMT3A-201; intron 1
Database links

Mature sequence ggo-miR-1301

Accession MIMAT0024158
Sequence

71 - 

uugcagcugccugggagugacu

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).