Stem-loop sequence ggo-mir-490

AccessionMI0020752 (change log)
DescriptionGorilla gorilla miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
   gccaugcug     -   aguucauu        c      --         g   caa   u 
5'          guuug gaa        guucgaca caugga  ucuccaggu ggu   guu a
            ||||| |||        |||||||| ||||||  ||||||||| |||   |||  
3'          cgaac cuu        cgaguugu guaccu  ggaggucca cca   uag g
   --------a     a   ------gu        c      ca         a   -cg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr7: 136325155-136325264 [+]
sense
ENSGGOT00000038545 ; ggo-mir-490-201; exon 1
ENSGGOT00000002956 ; CHRM2-201; intron 2
Database links

Mature sequence ggo-miR-490

Accession MIMAT0024205
Sequence

71 - 

caaccuggaggacuccaugcug

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).