Stem-loop sequence ggo-mir-505

AccessionMI0020775 (change log)
DescriptionGorilla gorilla miR-505 stem-loop
Gene family MIPF0000217; mir-505
Stem-loop
   ----------------uaaauu     ac    u           g    a        ucug 
5'                       gaugc  ccag gggggagccag aagu uugauguu    c
                         |||||  |||| ||||||||||| |||| ||||||||    c
3'                       cuacg  gguc cuccuuugguc uuca aacugcga    a
   uuacuuuuaggugcuugaaccg     -a    u           g    c        uuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chrX: 140004695-140004806 [-]
intergenic
Database links

Mature sequence ggo-miR-505

Accession MIMAT0024228
Sequence

58 - 

gucaacacuugcugguuucc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).