Stem-loop sequence ggo-mir-493

AccessionMI0020797 (change log)
DescriptionGorilla gorilla miR-493 stem-loop
Gene family MIPF0000230; mir-493
Stem-loop
   -----------ucauu     cuc        u                    cauuc  u 
5'                 cuggc   cagggcuu guacaugguaggcuuucauu     gu u
                   |||||   |||||||| ||||||||||||||||||||     ||  
3'                 gaccg   gucccgga cgugugucaucuggaagugg     ca g
   agguagaugugcuacg     --u        c                    -cuua  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr14: 84887397-84887506 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-493
ggo-mir-493chr14: 84887397-84887506 [+]
ggo-mir-337chr14: 84891732-84891840 [+]
Database links

Mature sequence ggo-miR-493

Accession MIMAT0024249
Sequence

21 - 

uuguacaugguaggcuuucau

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).