Stem-loop sequence ggo-mir-1343

AccessionMI0020805 (change log)
DescriptionGorilla gorilla miR-1343 stem-loop
Gene family MIPF0001206; mir-1343
Literature search

1 open access papers mention ggo-mir-1343
(2 sentences)

Stem-loop
   aaggagcaagacgaugauccu   g    u  -    ga    u        c     ucc 
5'                      ggc ucgg gc ugag  gcgg ccccgggg gggcu   g
                        ||| |||| || ||||  |||| |||||||| |||||    
3'                      ccg ggcc cg gcuc  cgcc gggguccu cccgg   c
   -------------cagcucgc   -    u  c    -a    c        c     ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr16: 31232623-31232730 [+]
sense
ENSGGOT00000013644 ; ggo-mir-1343-201; 3'UTR (exon 2)
Database links

Mature sequence ggo-miR-1343

Accession MIMAT0024257
Sequence

71 - 

cuccuggggcccgcacuc

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).