![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ggo-mir-200a |
||||||||
Accession | MI0020848 (change log) | |||||||
Description | Gorilla gorilla miR-200a stem-loop | |||||||
Gene family | MIPF0000019; mir-8 | |||||||
Stem-loop |
gggaccccacgucccucc - c g - ----------- a 5' cggg c ccu ugagcauc uuaccggacagu gcugg u |||| | ||| |||||||| |||||||||||| ||||| u 3' gccc g gga acuuguag aauggucuguca cgacc u -------------ucgcc a u a c caaucucaguu c |
|||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence ggo-miR-200a |
|
Accession | MIMAT0024300 |
Sequence |
71 - uaacacugucugguaacgaugu - 92 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22453055
"Annotation of primate miRNAs by high throughput sequencing of small RNA libraries"
BMC Genomics. 13:116(2012).
|