Stem-loop sequence ggo-mir-200a

AccessionMI0020848 (change log)
DescriptionGorilla gorilla miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   gggaccccacgucccucc    - c   g        -            -----------     a 
5'                   cggg c ccu ugagcauc uuaccggacagu           gcugg u
                     |||| | ||| |||||||| ||||||||||||           ||||| u
3'                   gccc g gga acuuguag aauggucuguca           cgacc u
   -------------ucgcc    a u   a        c            caaucucaguu     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr1: 809523-809633 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-200a
ggo-mir-200bchr1: 808769-808879 [+]
ggo-mir-200achr1: 809523-809633 [+]
ggo-mir-429chr1: 810595-810705 [+]
Database links

Mature sequence ggo-miR-200a

Accession MIMAT0024300
Sequence

71 - 

uaacacugucugguaacgaugu

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).