Stem-loop sequence ppy-mir-3661

AccessionMI0020936 (change log)
DescriptionPongo pygmaeus miR-3661 stem-loop
Gene family MIPF0001530; mir-3661
Stem-loop
   ----------------caccuuc    a    cu       -ug   c   ga      cuu  a 
5'                        ucgc gagg  cuugacc   gga ucg  uagcug   gc c
                          |||| ||||  |||||||   ||| |||  ||||||   ||  
3'                        agug uucc  gaacugg   ccu agc  gucgac   ug u
   accguaguaccugcucuuccaca    g    uc       uca   -   uc      --u  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr5: 135676110-135676221 [+]
intergenic
Database links

Mature sequence ppy-miR-3661

Accession MIMAT0024388
Sequence

21 - 

ugaccugggacucggauagcugc

 - 43

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).