Stem-loop sequence mse-mir-3338

AccessionMI0020981 (change log)
DescriptionManduca sexta miR-3338 stem-loop
Gene family MIPF0001449; mir-3338
Stem-loop
   aucaagaucaacacacac   ug     a        c     u     a   uaaagu 
5'                   gag  uuuca agcaaaca aguag gugca ugc      u
                     |||  ||||| |||||||| ||||| ||||| |||       
3'                   cuu  aaagu uuguuugu ucauu caugu acg      c
   ----------------au   gu     c        u     -     -   uacaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668320.1: 749003-749104 [+]
intergenic
Database links

Mature sequence mse-miR-3338

Accession MIMAT0024432
Sequence

70 - 

auguacuuacuuuguuuguucu

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).