Stem-loop sequence mse-mir-92a

AccessionMI0021020 (change log)
DescriptionManduca sexta miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   g     -  ---           c     -  u      c  u     -   u 
5'  uccgg ga   ggcccguuugg ugggc gg gacugg gc auauu cgg a
    ||||| ||   ||||||||||| ||||| || |||||| || ||||| ||| c
3'  gggcu cu   ccgggcgagcc auccg cc cugacc cg uauag guu g
   g     g  ggg           u     g  -      a  u     c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH669151.1: 7250-7351 [+]
intergenic
Clustered miRNAs
< 10kb from mse-mir-92a
mse-mir-92aJH669151.1: 7250-7351 [+]
mse-mir-92bJH669151.1: 7429-7530 [+]
Database links

Mature sequence mse-miR-92a

Accession MIMAT0024471
Sequence

58 - 

uauugcaccagucccggccuau

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).