Stem-loop sequence mse-mir-92b

AccessionMI0021037 (change log)
DescriptionManduca sexta miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
       u     -----       cu       c    a       acg   uguc 
5' ucac gcggu     ggccacg  uaggucg gauu gguguaa   uug    u
   |||| |||||     |||||||  ||||||| |||| |||||||   |||    g
3' agug cgccg     cuggugu  guccggc cuaa ccacguu   aac    u
       -     uaccg       uc       c    -       --a   uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH669151.1: 7429-7530 [+]
intergenic
Clustered miRNAs
< 10kb from mse-mir-92b
mse-mir-92aJH669151.1: 7250-7351 [+]
mse-mir-92bJH669151.1: 7429-7530 [+]
Database links

Mature sequence mse-miR-92b

Accession MIMAT0024487
Sequence

59 - 

aauugcaccaaucccggccugc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).