Stem-loop sequence cca-MIR6107

AccessionMI0021092 (change log)
DescriptionCynara cardunculus miR6107 stem-loop
Stem-loop
   -  a                      g            a     --cc   auu 
5'  ca ccaacuguaccagauguugucc cuuuauccacac ugggc    aca   u
    || |||||||||||||||||||||| |||||||||||| |||||    |||   u
3'  gu gguuggcauggucuauaacagg gaaauaggugug accug    ugu   a
   a  c                      g            g     ucuu   aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6107

Accession MIMAT0024541
Sequence

80 - 

aaaggggacaauaucugguacggu

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).