Stem-loop sequence cca-MIR6118

AccessionMI0021111 (change log)
DescriptionCynara cardunculus miR6118 stem-loop
Literature search

1 open access papers mention cca-MIR6118
(1 sentences)

Stem-loop
   -  c  c      u     -            -uga      -----      --   -   c 
5'  ag ug uggaau gggug cuucggaagaaa    aaucga     uucaua  uca uca c
    || || |||||| ||||| ||||||||||||    ||||||     ||||||  ||| |||  
3'  uc gc accuua cccac ggagccuuuuuu    uuggcu     agguau  agu agu g
   c  u  a      -     c            uuag      acguu      cu   u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6118-5p

Accession MIMAT0024565
Sequence

7 - 

uggaauugggugcuucggaaga

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cca-miR6118-3p

Accession MIMAT0024566
Sequence

90 - 

uuccgaggccacccauuccaac

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).