Stem-loop sequence bta-mir-6121

AccessionMI0021139 (change log)
DescriptionBos taurus miR-6121 stem-loop
Stem-loop
   ccuc     ------       ----   ga  c  c 
5'     ggagc      gcccucg    cca  ca cc u
       |||||      |||||||    |||  || || g
3'     ccucg      cgggagu    ggu  gu gg c
   ---a     gucgga       caca   -a  a  c 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 77366284-77366346 [+]
sense
ENSBTAT00000001558 ; PLXNA2-201; intron 36
Database links

Mature sequence bta-miR-6121-5p

Accession MIMAT0024592
Sequence

3 - 

ucggagcgcccucgccagac

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-6121-3p

Accession MIMAT0024593
Sequence

30 - 

ccggaugauggacacugagg

 - 49

Get sequence
Deep sequencing35 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).