Stem-loop sequence nta-MIR479b

AccessionMI0021414 (change log)
DescriptionNicotiana tabacum miR479b stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

1 open access papers mention nta-MIR479b
(3 sentences)

Stem-loop
   --u  g   u  c        u             c      uu  -au  a 
5'    ca aca gg gugauauu guuuggcucauca uuucug  ga   uc u
      || ||| || |||||||| ||||||||||||| ||||||  ||   ||  
3'    gu ugu uc cacuauaa caagccgaguagu agagac  cu   ag g
   uuc  a   -  u        c             -      --  gac  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR479b

Accession MIMAT0024724
Sequence

11 - 

cgugauauuuguuuggcucauc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).