Stem-loop sequence nta-MIR6148b

AccessionMI0021428 (change log)
DescriptionNicotiana tabacum miR6148b stem-loop
Stem-loop
   ac        u          uu      c 
5'   ccgaaauu guguuaaucg  uguucu a
     |||||||| ||||||||||  |||||| a
3'   ggcuuuga cacaauuagc  acaaga c
   uc        c          uu      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR6148b

Accession MIMAT0024738
Sequence

11 - 

uguguuaaucguuuguucuca

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).