Stem-loop sequence hbr-MIR6167

AccessionMI0021475 (change log)
DescriptionHevea brasiliensis miR6167 stem-loop
Stem-loop
   -  ca    ag ccaau                                           a  auc   g 
5'  gu  gcca  c     gggucaaagcuuccaccuggguagauugggucugugaccuuac ga   gcc g
    ||  ||||  |     ||||||||||||||||||||||||||||||||||||||||||| ||   |||  
3'  ca  cggu  g     uccaguuucgaagguggacccaucuaacccagacacuggagug cu   cgg u
   c  cc    ga -ccac                                           g  cac   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hbr-miR6167

Accession MIMAT0024785
Sequence

102 - 

uacccagguggaagcuuuga

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22407387 "Genome-wide analysis of microRNAs in rubber tree (Hevea brasiliensis L.) using high-throughput sequencing" Lertpanyasampatha M, Gao L, Kongsawadworakul P, Viboonjun U, Chrestin H, Liu R, Chen X, Narangajavana J Planta. 236:437-445(2012).