Stem-loop sequence hbr-MIR6173

AccessionMI0021483 (change log)
DescriptionHevea brasiliensis miR6173 stem-loop
Stem-loop
   -----------------        -                             aa   a    agcggaa    auu 
5'                  cgcugugc guaucgacccgugcaguauccaucguuua  gcu gggg       uggg   a
                    |||||||| |||||||||||||||||||||||||||||  ||| ||||       ||||   g
3'                  gcgacacg cauagcugggcacgucauagguagcaaau  cga uccu       accc   a
   auugcgcaaucgauguc        g                             gc   a    ---gaug    cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hbr-miR6173

Accession MIMAT0024793
Sequence

81 - 

agccguaaacgauggauacu

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22407387 "Genome-wide analysis of microRNAs in rubber tree (Hevea brasiliensis L.) using high-throughput sequencing" Lertpanyasampatha M, Gao L, Kongsawadworakul P, Viboonjun U, Chrestin H, Liu R, Chen X, Narangajavana J Planta. 236:437-445(2012).