Stem-loop sequence hvu-MIR5049d

AccessionMI0021503 (change log)
DescriptionHordeum vulgare miR5049d stem-loop
Gene family MIPF0001200; MIR5067
Literature search

2 open access papers mention hvu-MIR5049d
(4 sentences)

Stem-loop
   auucua          a  a         c      a        ga 
5'       cuuccucugu cc aaauaauug aguugg gagaaaua  c
         |||||||||| || ||||||||| |||||| ||||||||   
3'       gagggaggca gg uuuauuaac ucaacc cucuuuau  u
   uuuuaa          a  a         a      c        ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Hvul_cvHarunaNijo3HBAC01; GCA_000227425.1) Overlapping transcripts
BACC01005699.1: 5031-5126 [-]
intergenic
Database links

Mature sequence hvu-miR5049d

Accession MIMAT0024813
Sequence

66 - 

uacaauuauuuaggaacggag

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22489137 "Identification and characterization of microRNAs from barley (Hordeum vulgare L.) by high-throughput sequencing" Lv S, Nie X, Wang L, Du X, Biradar SS, Jia X, Weining S Int J Mol Sci. 13:2973-2984(2012).