Stem-loop sequence hme-mir-281

AccessionMI0021762 (change log)
DescriptionHeliconius melpomene miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   -----cuucguccaaagaagca    ua       a           -ua     c      a  ga 
5'                       ccua  aucuguu augaagagagc   uccgu gacagu uu  c
                         ||||  ||||||| |||||||||||   ||||| |||||| ||  a
3'                       gggu  uaggcaa uauuucucucg   aggua cuguca aa  c
   gaagaugucguaucauucaucu    cg       g           uug     -      c  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE671164: 1105652-1105781 [+]
intergenic
Database links

Mature sequence hme-miR-281

Accession MIMAT0024967
Sequence

70 - 

acugucauggaguugcucucuu

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).