Stem-loop sequence hme-mir-305

AccessionMI0021769 (change log)
DescriptionHeliconius melpomene miR-305 stem-loop
Gene family MIPF0000158; mir-305
Stem-loop
          -    cccau         u       u    u   a 
5' gccgccg cacg     uguacuuca caggugc cugg gau a
   ||||||| ||||     ||||||||| ||||||| |||| |||  
3' uggcggc gugc     acaugaggu guucgcg gacc uug u
          u    cauuc         u       -    -   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE669248: 31851-31937 [+]
intergenic
Database links

Mature sequence hme-miR-305

Accession MIMAT0024974
Sequence

15 - 

auuguacuucaucaggugcucu

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).