Stem-loop sequence hme-mir-92a

AccessionMI0021790 (change log)
DescriptionHeliconius melpomene miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   -guua  c   uc     -----aga      gg   c     -  u      c  u    ua   g 
5'      gu agu  gucuc        ggcccg  ugg ugggc gg gauugg gc auau  ugu u
        || |||  |||||        ||||||  ||| ||||| || |||||| || ||||  |||  
3'      ca ucg  cagag        ccgggc  acc auccg cc cugacc cg uaua  aca g
   cgaca  -   -c     gccuccgg      aa   u     g  -      a  u    --   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE672043: 128895-129018 [+]
intergenic
Clustered miRNAs
< 10kb from hme-mir-92a
hme-mir-92aHE672043: 128895-129018 [+]
hme-mir-92bHE672043: 129043-129161 [+]
Database links

Mature sequence hme-miR-92a

Accession MIMAT0024993
Sequence

68 - 

uauugcaccagucccggccuau

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).