Stem-loop sequence hme-mir-6310

AccessionMI0021812 (change log)
DescriptionHeliconius melpomene miR-6310 stem-loop
Stem-loop
   u      u   --             u   -a  -  cca 
5'  gugauc aaa  gugucacauuccu ccu  gc ca   a
    |||||| |||  ||||||||||||| |||  || ||   u
3'  cacugg uuu  cacaguguaaggg gga  ug gu   u
   a      u   aa             u   cc  c  cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE671687: 123810-123888 [-]
intergenic
Database links

Mature sequence hme-miR-6310-3p

Accession MIMAT0025017
Sequence

48 - 

ccaggugggaaugugacacaau

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).