Stem-loop sequence sma-mir-3479

AccessionMI0021826 (change log)
DescriptionSchistosoma mansoni miR-3479 stem-loop
Gene family MIPF0001629; mir-3479
Literature search

1 open access papers mention sma-mir-3479
(10 sentences)

Stem-loop
   --c       ug   g   u   u       u  gugu 
5'    auguuug  agg gga guu gugcaau ua    u
      |||||||  ||| ||| ||| ||||||| ||     
3'    uauaaac  ucc cuu caa cacguua au    g
   gga       gu   g   c   u       u  aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_4.unplaced.SC_0032: 1561284-1561359 [-]
intergenic
Database links

Mature sequence sma-miR-3479-3p

Accession MIMAT0025039
Sequence

45 - 

uauugcacuaaccuucgccuug

 - 66

Get sequence
Evidence not experimental

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).