Stem-loop sequence mmu-mir-6336

AccessionMI0021864 (change log)
Symbol MGI:Mir6336
DescriptionMus musculus miR-6336 stem-loop
Stem-loop
   u     --c     a   aca    uguaa    --   -         g        -   uu  gu 
5'  uccuu   ucaug aag   cuug     gcau  uuc ucggauuua uaagagau cuu  au  a
    |||||   ||||| |||   ||||     ||||  ||| ||||||||| |||||||| |||  ||   
3'  aggaa   gguac uuc   gagu     ugua  agg agucuggau auuuucua gag  ug  u
   u     uua     a   -gg    uaaaa    aa   u         -        u   uc  ag 
Get sequence
Deep sequencing
14 reads, 36.4 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 42447439-42447568 [-]
sense
OTTMUST00000029305 ; Lrp1b-001; intron 1
OTTMUST00000029310 ; Lrp1b-006; intron 1
OTTMUST00000029311 ; Lrp1b-007; intron 1
ENSMUST00000052550 ; Lrp1b-001; intron 1
ENSMUST00000138700 ; Lrp1b-007; intron 1
ENSMUST00000133104 ; Lrp1b-006; intron 1
Database links

Mature sequence mmu-miR-6336

Accession MIMAT0025079
Sequence

34 - 

ucucggauuuaguaagagauc

 - 54

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).