Stem-loop sequence mmu-mir-6359

AccessionMI0021887 (change log)
Symbol MGI:Mir6359
DescriptionMus musculus miR-6359 stem-loop
Stem-loop
   ----a      g   -   -aga       cug  g     cau 
5'      cugauu ugg cgg    gaugguu   gc gggcu   c
        |||||| ||| |||    |||||||   || |||||    
3'      gacugg acc guu    cugucaa   ug cucga   a
   gagaa      g   c   guag       ---  g     agg 
Get sequence
Deep sequencing
42 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 88972030-88972110 [+]
sense
ENSMUST00000023828 ; Rttn-201; 3'UTR (exon 1)
Database links

Mature sequence mmu-miR-6359

Accession MIMAT0025102
Sequence

58 - 

cgauguugcccagggucagaa

 - 78

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).